Class TestCasesStructuralInv
Gene models used in these test cases:
Gene: Gene_1:953-1216 1:957-1157, strand: +, id:transcript_0, Protein Exons: 1:957-988 'exon_0_0', rank: 1, frame: ., sequence: gttgcttgaatactgtatagccttgccattgt 1:1045-1057 'exon_0_1', rank: 2, frame: ., sequence: tgtgttgctaact 1:1148-1157 'exon_0_2', rank: 3, frame: ., sequence: agacatggac CDS : gttgcttgaatactgtatagccttgccattgttgtgttgctaactagacatggac Protein : VA*ILYSLAIVVLLTRHG?
1 0 1 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567 gttgcttgaatactgtatagccttgccattgt........................................................tgtgttgctaact..........................................................................................agacatggac V A * I L Y S L A I V V L L T R H G 01201201201201201201201201201201 2012012012012 0120120120 >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>-------------------------------------------------------->>>>>>>>>>>>>------------------------------------------------------------------------------------------>>>>>>>>>> | | | | | | | | | | | ^1157 | | | | ^1148 | | | ^1057 | | ^1045 | ^988 ^957
Gene: Gene_1:2057-2157 1:2066-2141, strand: +, id:transcript_1, Protein Exons: 1:2066-2069 'exon_1_0', rank: 1, frame: ., sequence: actt 1:2084-2089 'exon_1_1', rank: 2, frame: ., sequence: cccttt 1:2116-2126 'exon_1_2', rank: 3, frame: ., sequence: tacgcccacgt 1:2133-2141 'exon_1_3', rank: 4, frame: ., sequence: ccgccgctg CDS : acttcccttttacgcccacgtccgccgctg Protein : TSLLRPRPPL
1 7 8 9 0 1 2 3 4 6789012345678901234567890123456789012345678901234567890123456789012345678901 actt..............cccttt..........................tacgcccacgt......ccgccgctg T S L L R P R P P L 0120 120120 12012012012 012012012 >>>>-------------->>>>>>-------------------------->>>>>>>>>>>------>>>>>>>>> | | | | | | | | | | | | | | | ^2141 | | | | | | ^2133 | | | | | ^2126 | | | | ^2116 | | | ^2089 | | ^2084 | ^2069 ^2066
-
Field Summary
Fields inherited from class org.snpeff.snpEffect.testCases.unity.TestCasesBase
addUtrs, BASE_DIR, chromoBases, chromoSequence, chromosome, codonTable, config, debug, gene, genome, genomeName, maxExons, maxGeneLen, maxTranscripts, minExons, numGenes, onlyMinusStrand, onlyPlusStrand, prefixes, rand, randSeed, shiftHgvs, snpEffectPredictor, spliceRegionExonSize, spliceRegionIntronMax, spliceRegionIntronMin, testType, transcript, verbose -
Constructor Summary
Constructors -
Method Summary
Modifier and TypeMethodDescriptionprotected voidcheckEffects(Variant variant, EffectType[] expEffs, String[] expHgvsc, VariantEffect.EffectImpact expectedImpact, String[] expAnns) protected voidcheckEffects(Variant variant, EffectType[] expEffs, String[] expHgvsc, VariantEffect.EffectImpact expectedImpact, String[] expAnns, Gene[] genesToAdd) protected voidinit()voidInversion: Whole genevoidInversion: whole transcriptvoidtest02()Inversion: One coding exonvoidtest03()Inversion: Two coding exonsvoidtest04()Inversion: Part of one coding exonvoidtest05()Inversion: Part of two coding exonvoidtest06()Inversion: Two genesvoidtest07()Inversion: Part of two genes (fusions) cutting on intronsvoidtest08()Inversion: Part of two genes (fusions) cutting exonsvoidtest09()Inversion: Intronvoidtest10()Inversion creating a fusion between two pairs (i.e.Methods inherited from class org.snpeff.snpEffect.testCases.unity.TestCasesBase
after, before, checkApply, checkApplyDel, checkApplyIns, checkApplyMixed, checkApplyMnp, checkApplySnp, checkEffect, checkEffect, formatVersion, hasEffect, initRand, initSnpEffPredictor, initSnpEffPredictor, path, pathClassName, prependSequenceToFirstExon
-
Constructor Details
-
TestCasesStructuralInv
public TestCasesStructuralInv()
-
-
Method Details
-
checkEffects
protected void checkEffects(Variant variant, EffectType[] expEffs, String[] expHgvsc, VariantEffect.EffectImpact expectedImpact, String[] expAnns) -
checkEffects
protected void checkEffects(Variant variant, EffectType[] expEffs, String[] expHgvsc, VariantEffect.EffectImpact expectedImpact, String[] expAnns, Gene[] genesToAdd) -
init
protected void init()- Overrides:
initin classTestCasesBase
-
test01_invGene
@Test public void test01_invGene()Inversion: Whole gene -
test01_invTr
@Test public void test01_invTr()Inversion: whole transcript -
test02
@Test public void test02()Inversion: One coding exon -
test03
@Test public void test03()Inversion: Two coding exons -
test04
@Test public void test04()Inversion: Part of one coding exon -
test05
@Test public void test05()Inversion: Part of two coding exon -
test06
@Test public void test06()Inversion: Two genes -
test07
@Test public void test07()Inversion: Part of two genes (fusions) cutting on introns -
test08
@Test public void test08()Inversion: Part of two genes (fusions) cutting exons -
test09
@Test public void test09()Inversion: Intron -
test10
@Test public void test10()Inversion creating a fusion between two pairs (i.e. four genes)
-