Package org.snpeff.snpEffect.testCases.unity

Class TestCasesStructuralDel

java.lang.Object
org.snpeff.snpEffect.testCases.unity.TestCasesBase
org.snpeff.snpEffect.testCases.unity.TestCasesStructuralDel
public class TestCasesStructuralDel extends TestCasesBase
Test case Gene: geneId1 1:957-1157, strand: +, id:transcript_0, Protein Exons: 1:957-988 'exon_0_0', rank: 1, frame: ., sequence: gttgcttgaatactgtatagccttgccattgt 1:1045-1057 'exon_0_1', rank: 2, frame: ., sequence: tgtgttgctaact 1:1148-1157 'exon_0_2', rank: 3, frame: ., sequence: agacatggac CDS : gttgcttgaatactgtatagccttgccattgttgtgttgctaactagacatggac Protein : VA*ILYSLAIVVLLTRHG?

1 0 1 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567 gttgcttgaatactgtatagccttgccattgt........................................................tgtgttgctaact..........................................................................................agacatggac V A * I L Y S L A I V V L L T R H G 01201201201201201201201201201201 2012012012012 0120120120 >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>-------------------------------------------------------->>>>>>>>>>>>>------------------------------------------------------------------------------------------>>>>>>>>>> | | | | | | | | | | | ^1157 | | | | ^1148 | | | ^1057 | | ^1045 | ^988 ^957

Gene: geneId2 1:2066-2141, strand: +, id:transcript_1, Protein Exons: 1:2066-2069 'exon_1_0', rank: 1, frame: ., sequence: actt 1:2084-2089 'exon_1_1', rank: 2, frame: ., sequence: cccttt 1:2116-2126 'exon_1_2', rank: 3, frame: ., sequence: tacgcccacgt 1:2133-2141 'exon_1_3', rank: 4, frame: ., sequence: ccgccgctg CDS : acttcccttttacgcccacgtccgccgctg Protein : TSLLRPRPPL

1 7 8 9 0 1 2 3 4 6789012345678901234567890123456789012345678901234567890123456789012345678901 actt..............cccttt..........................tacgcccacgt......ccgccgctg T S L L R P R P P L 0120 120120 12012012012 012012012 >>>>-------------->>>>>>-------------------------->>>>>>>>>>>------>>>>>>>>> | | | | | | | | | | | | | | | ^2141 | | | | | | ^2133 | | | | | ^2126 | | | | ^2116 | | | ^2089 | | ^2084 | ^2069 ^2066

  • Constructor Details

    • TestCasesStructuralDel

      public TestCasesStructuralDel()

  • Method Details

    • checkEffects

      protected void checkEffects(Variant variant, EffectType[] expEffs, String[] expHgvsp, String[] expHgvsc, VariantEffect.EffectImpact expectedImpact, String[] expAnns)

    • init

      protected void init()
      Overrides:
      init in class TestCasesBase

    • test01_delGene

      @Test public void test01_delGene()
      Deletion Whole gene / whole transcript

    • test01_delTr

      @Test public void test01_delTr()
      Deletion Whole gene / whole transcript

    • test02

      @Test public void test02()
      Deletion One coding exon

    • test03

      @Test public void test03()
      Deletion two coding exons (within the same gene)

    • test04

      @Test public void test04()
      Deletion Part of one coding exon

    • test05

      @Test public void test05()
      Deletion Part of two coding exons (within the same gene)

    • test06

      @Test public void test06()
      Deletion one genes and part of another gene

    • test07

      @Test public void test07()
      Deletion after gene's coding region (LOW impact)

    • test08

      @Test public void test08()
      Deletion Part of two genes cutting on introns

    • test09

      @Test public void test09()
      Deletion Part of two genes cutting exons

    • test10

      @Test public void test10()
      Deletion Intron