Package org.snpeff.snpEffect.testCases.unity

Class TestCasesBase

java.lang.Object
org.snpeff.snpEffect.testCases.unity.TestCasesBase
Direct Known Subclasses:
TestCasesAnn, TestCasesAnnParse, TestCasesBaseApply, TestCasesBuild, TestCasesCds, TestCasesDels, TestCasesDnaSequence, TestCasesEffectCollapse, TestCasesEffectCollapse2, TestCasesFasta, TestCasesFileIndexChrPos, TestCasesHgvs, TestCasesHgvsDnaDup, TestCasesHgvsDnaDupNegative, TestCasesHgvsProtDup, TestCasesIns, TestCasesIntergenic, TestCasesIntervals, TestCasesIntervalVariant, TestCasesIntStats, TestCasesJaspar, TestCasesMnps, TestCasesSeekableReader, TestCasesSequenceIndexer, TestCasesSnps, TestCasesSpliceRegion, TestCasesSpliceSite, TestCasesStructuralDel, TestCasesStructuralDup, TestCasesStructuralInv, TestCasesVariantRealignment, TestCasesVcf, TestCasesZzz
public class TestCasesBase extends Object
Base class for some test cases
Author:
pcingola

  • Field Details

    • BASE_DIR

      public static final String BASE_DIR
      See Also:

    • debug

      protected boolean debug

    • verbose

      protected boolean verbose

    • randSeed

      protected int randSeed

    • genomeName

      protected String genomeName

    • addUtrs

      protected boolean addUtrs

    • onlyPlusStrand

      protected boolean onlyPlusStrand

    • onlyMinusStrand

      protected boolean onlyMinusStrand

    • shiftHgvs

      protected boolean shiftHgvs

    • numGenes

      protected int numGenes

    • maxGeneLen

      protected int maxGeneLen

    • maxTranscripts

      protected int maxTranscripts

    • maxExons

      protected int maxExons

    • minExons

      protected int minExons

    • spliceRegionExonSize

      protected int spliceRegionExonSize

    • spliceRegionIntronMin

      protected int spliceRegionIntronMin

    • spliceRegionIntronMax

      protected int spliceRegionIntronMax

    • rand

      protected Random rand

    • config

      protected Config config

    • genome

      protected Genome genome

    • chromosome

      protected Chromosome chromosome

    • gene

      protected Gene gene

    • transcript

      protected Transcript transcript

    • snpEffectPredictor

      protected SnpEffectPredictor snpEffectPredictor

    • chromoSequence

      protected String chromoSequence

    • chromoBases

      protected char[] chromoBases

    • codonTable

      protected CodonTable codonTable

    • testType

      protected String testType

    • prefixes

      protected List<String> prefixes

  • Constructor Details

    • TestCasesBase

      public TestCasesBase()

  • Method Details

    • after

      @AfterEach public void after()

    • before

      @BeforeEach public void before()

    • checkApply

      public void checkApply(Variant variant, Variant.VariantType varType, String expectedCds, String expectedProtein, int exonRank, int expectedExon1Start, int expectedExon1End)
      Apply a variant to a transcript and check resulting CDS sequence, protein sequence and exon coordinates

    • checkApplyDel

      public void checkApplyDel(Variant variant, String expectedCds, String expectedProtein, int exonRank, int expectedExon1Start, int expectedExon1End)

    • checkApplyIns

      public void checkApplyIns(Variant variant, String expectedCds, String expectedProtein, int exonRank, int expectedExon1Start, int expectedExon1End)

    • checkApplyMixed

      public void checkApplyMixed(Variant variant, String expectedCds, String expectedProtein, int exonRank, int expectedExon1Start, int expectedExon1End)

    • checkApplyMnp

      public void checkApplyMnp(Variant variant, String expectedCds, String expectedProtein, int exonRank, int expectedExon1Start, int expectedExon1End)

    • checkApplySnp

      public void checkApplySnp(Variant variant, String expectedCds, String expectedProtein, int exonRank, int expectedExon1Start, int expectedExon1End)

    • checkEffect

      protected void checkEffect(Variant variant, EffectType effectExpected)

    • checkEffect

      protected void checkEffect(Variant variant, EffectType effectExpected, EffectType effectNotExpected, VariantEffect.EffectImpact impact)

    • formatVersion

      protected EffFormatVersion formatVersion(String vcfFileName)
      Get file's format version

    • hasEffect

      protected boolean hasEffect(String effectExpected, String effStr)
      Is effectExpected included in effStr (many effects delimited by '&'

    • init

      protected void init()

    • initRand

      protected void initRand()

    • initSnpEffPredictor

      protected void initSnpEffPredictor()

    • initSnpEffPredictor

      protected void initSnpEffPredictor(Gene[] genesToAdd)
      Create a predictor For the default parameters the first predictor created has only one transcript: 1:880-1001, strand: +, id:transcript_0, Protein Exons: 1:880-1001 'exon_0_0', rank: 1, frame: ., sequence: taaccccatatgattagtacggtagaggaaaagcacctaacccccattgagcaggatctctttcgtaatactctgtatcgatgaccgatttatttgattccccacatttatttcatcggga CDS : taaccccatatgattagtacggtagaggaaaagcacctaacccccattgagcaggatctctttcgtaatactctgtatcgatgaccgatttatttgattccccacatttatttcatcgggac Protein : *PHMISTVEEKHLTPIEQDLFRNTLYR*PIYLIPHIYFIG?

    • path

      public String path(String fileName)

    • pathClassName

      protected String pathClassName()

    • prependSequenceToFirstExon

      protected void prependSequenceToFirstExon(String prepend)
      Prepend first's exons sequence with a given one